Assessing Non-synonymous Single Nucleotide Polymorphism of IGF-1 Gene Sequence in Three Nigerian Local Chicken Strains
Isaac, L. J. *
Department of Animal Science, University of Uyo, Uyo, Nigeria.
Okon, B.
Department of Animal Science, University of Calabar, Calabar, Nigeria.
Ibom, L. A.
Department of Animal Science, University of Calabar, Calabar, Nigeria.
*Author to whom correspondence should be addressed.
Abstract
Local chicken strains – normal feathered, frizzle feathered and naked neck – were used in this study to assess the single nucleotide polymorphism of insulin like growth factor -1 (IGF-1) gene. A total of sixty (60) chickens (twenty (20) from each strain, from which fifteen (15) - five (5) was sampled per strain for blood collection and DNA extraction) were involved in the work. Jena Bioscience Gmbh preparation kit was used in extracting DNA, while the Shine Gene Primers given by:
GTCGGGCTACTTGAGTTACTAC – Forward.
TTGCGCAGGCTCTATCTGCTC - Reverse.
was used to identify genomic DNA for sequencing of the gene (IGF-1). 2% agarose gel was used to assess the DNA purity. Results showed the polymorphism of IGF-1 gene in these strains with the neutral (beneficial) variants being more predominant and as such the tendency to influence the expression of more traits. Thus, making IGF-1 a marker of interest in the genomic selection of chicken for development and improvement.
Keywords: Synonymous, gene sequence, single nucleotide polymorphism, IGF-1, local chicken